View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9189_low_13 (Length: 311)
Name: NF9189_low_13
Description: NF9189
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9189_low_13 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 99; Significance: 7e-49; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 99; E-Value: 7e-49
Query Start/End: Original strand, 19 - 151
Target Start/End: Original strand, 29030377 - 29030502
Alignment:
| Q |
19 |
gacaatagtttacaattgtaaatccaaccctatatctagcagctagcagctagcatccaaagatgaaactatttcacatatgttgtctagaaagtctttg |
118 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
29030377 |
gacaatagtttacaattgtaaatccaaccctatatctag-------cagctagcatccaaagatgaaattatttcacatatgttgtctagaaagtctttg |
29030469 |
T |
|
| Q |
119 |
tcaaacactttctatatgagataattaatttca |
151 |
Q |
| |
|
||||| ||||||||||||||||||||||||||| |
|
|
| T |
29030470 |
tcaaatactttctatatgagataattaatttca |
29030502 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 59; E-Value: 5e-25
Query Start/End: Original strand, 170 - 267
Target Start/End: Original strand, 29030488 - 29030586
Alignment:
| Q |
170 |
agataactaatttcagaagtataagttcaaaagnnnnnnnn-ttaaggacataaaataattcattgatacaaagagagtttgcaacataatcattgtta |
267 |
Q |
| |
|
|||||| ||||||||||||||||||||| |||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29030488 |
agataattaatttcagaagtataagttcgaaagaaaaaaaaattaaggacataaaataattcattgatacaaagagagtttgcaacataatcattgtta |
29030586 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University