View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9191_low_12 (Length: 292)
Name: NF9191_low_12
Description: NF9191
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9191_low_12 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 163; Significance: 4e-87; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 163; E-Value: 4e-87
Query Start/End: Original strand, 18 - 275
Target Start/End: Complemental strand, 39837891 - 39837626
Alignment:
| Q |
18 |
agagttaactattttcagcaatcgataattaaataatgctcaataatctatggcattatgaaagcactagtttgannnnnnnnnnnnnnnnnnnaagttg |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
39837891 |
agagttaactattttcagcaatcgataattaaataatgctcaataatctatggcattatgaaagcactagtttgatttttatttttttaattttaagttg |
39837792 |
T |
|
| Q |
118 |
aagaacttataaagcaatata----gctgataatccgataacatatgcagattcagcactgagattttaacttgaacttttcacgtacatgaagatataa |
213 |
Q |
| |
|
||||||||||||||||||||| ||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39837791 |
aagaacttataaagcaatatatatagctgatagtccgataacatatgcagattcagcactgagattttaacttgaacttttcacgtacatgaagatataa |
39837692 |
T |
|
| Q |
214 |
tactcagattccacttaccacaaaatccactgacatat----tttgataaatagtttgtaccaagt |
275 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||| ||||||||||||| |||||||||| |
|
|
| T |
39837691 |
tactcagattccatttaccacaaaatccactgacatattttgtttgataaatagtctgtaccaagt |
39837626 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University