View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9191_low_13 (Length: 256)
Name: NF9191_low_13
Description: NF9191
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9191_low_13 |
 | |
|
| [»] scaffold0018 (1 HSPs) |
| | |
|
Alignment Details
Target: scaffold0018 (Bit Score: 237; Significance: 1e-131; HSPs: 1)
Name: scaffold0018
Description:
Target: scaffold0018; HSP #1
Raw Score: 237; E-Value: 1e-131
Query Start/End: Original strand, 1 - 249
Target Start/End: Original strand, 35098 - 35346
Alignment:
| Q |
1 |
tctattaatggtttcacttgattcccttgaacggaagcagatattgaaggttttctcaagttgtctatttgaccacggttgatattaatatcactagaag |
100 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35098 |
tctatgaatggtttcacttgattcccttgaacggaagcagatattgaaggttttctcaagttgtctatttgaccacggttgatattaatatcactagaag |
35197 |
T |
|
| Q |
101 |
atgacaaagtaacactatttctcttttgcatttgaaatttcttttgaaaaagtcgaacccgttcaagctcagacttaaacctattggcaacttgttttct |
200 |
Q |
| |
|
| ||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35198 |
acgacaaagtaacaccatttctcttttgcatttgaaatttcttttgaaaaagtcgaacccgttcaagctcagacttaaacctattggcaacttgttttct |
35297 |
T |
|
| Q |
201 |
ttgaaaagctgacaattttgacaaaggaacaagttgcattggaacacca |
249 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35298 |
ttgaaaagctgacaattttgacaaaggaacaagttgcattggaacacca |
35346 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University