View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9192_low_11 (Length: 291)
Name: NF9192_low_11
Description: NF9192
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9192_low_11 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 204; Significance: 1e-111; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 204; E-Value: 1e-111
Query Start/End: Original strand, 13 - 288
Target Start/End: Complemental strand, 20623756 - 20623481
Alignment:
| Q |
13 |
tggagttaaaaacggaggatgatgaaatgatataattagccaagaaaacattttaggaagtttcaaacaagaaattcgataacattgcaataaaccttta |
112 |
Q |
| |
|
|||| ||||||| |||||||||||||||||| || ||||||||||||||||||||||||||||||||||||||| | ||||| ||||||||||||||||| |
|
|
| T |
20623756 |
tggacttaaaaatggaggatgatgaaatgatttagttagccaagaaaacattttaggaagtttcaaacaagaaacttgataagattgcaataaaccttta |
20623657 |
T |
|
| Q |
113 |
caatccagaagaaataatgtttcaaagatcaggtcaaggttttaatgtaaggttgcaattcttgatgtagaggaaaattatgaacaaatgtgatttatgt |
212 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||||||||||| |||||||||||| ||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
20623656 |
caatccagaagaaaaaatgtttcaaagatcaggtcaaggttttaaagtaaggttgcaagtcttgatgtagaggaaacttatgaacaaatgtgatttatgt |
20623557 |
T |
|
| Q |
213 |
ggccgcagttgcagtcacggtcgattaatcacagaggcaacaaaatcctcgacagtgtgattaaaattgcaattgt |
288 |
Q |
| |
|
| | |||||||||||||| ||||||||||||||||||||||||||||||| ||| |||||| | |||||||||||| |
|
|
| T |
20623556 |
gactgcagttgcagtcacagtcgattaatcacagaggcaacaaaatcctctacattgtgatcacaattgcaattgt |
20623481 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University