View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9192_low_14 (Length: 271)
Name: NF9192_low_14
Description: NF9192
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9192_low_14 |
 |  |
|
| [»] chr1 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 199; Significance: 1e-108; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 199; E-Value: 1e-108
Query Start/End: Original strand, 1 - 271
Target Start/End: Original strand, 20623251 - 20623521
Alignment:
| Q |
1 |
cattggactggttctctgctcctggaattcccccaattcactgtcctcaaaccagtgtttcatgttcaggtaataatcggcaatagatagtaatagatac |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||| |||||||||||||||| |||||||||||||||||||| | |||| ||||||||||| || |
|
|
| T |
20623251 |
cattggactggttctctgctcctggaattcctccaattcattgtcctcaaaccagtgcttcatgttcaggtaataatcagaaatacatagtaatagacac |
20623350 |
T |
 |
| Q |
101 |
ggttataattgtttcaatcgttacatttagtcggcataaaagaccccaaacccagtttgcacaaatgcaacaagacacgtccttttggtagaaaccgtgt |
200 |
Q |
| |
|
||||||||||||||||||| |||||||||||||| ||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
20623351 |
ggttataattgtttcaatcattacatttagtcggaataaaagaccccaaacccagtttgctcaaatgcaacaagacacgtccttttggtagaaaccatgt |
20623450 |
T |
 |
| Q |
201 |
ttggaagttttccaacgtctaattgcggctacaattgcaattttaatcacaatgtcgcggcttttgttgcc |
271 |
Q |
| |
|
|||||||| |||||||||||||||||||| |||||||||||| | |||||||||| | || |||||||||| |
|
|
| T |
20623451 |
ttggaagtcttccaacgtctaattgcggccacaattgcaattgtgatcacaatgtagaggattttgttgcc |
20623521 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University