View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9193_low_2 (Length: 235)
Name: NF9193_low_2
Description: NF9193
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9193_low_2 |
 |  |
|
| [»] chr4 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 219; Significance: 1e-120; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 219; E-Value: 1e-120
Query Start/End: Original strand, 13 - 235
Target Start/End: Complemental strand, 26018528 - 26018306
Alignment:
| Q |
13 |
tatatatgttctctaattatgtgcattaacgtggttagattcctgtggggcaaactgcataatgttcatatggataggaaaagacgaactgtactttact |
112 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
26018528 |
tatatatgttctctaattatgtgcattaacgtggttagattcctgtggggcaaactgcataatgttcatatggataggaaaagacaaactgtactttact |
26018429 |
T |
 |
| Q |
113 |
atgtaccaaaataagtgatatctcaaagtcacacatcaatcctacaatgcaattatttttacagtttgataataacagttgaacgtttggtaagtgccaa |
212 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26018428 |
atgtaccaaaataagtgatatctcaaagtcacacatcaatcctacaatgcaattatttttacagtttgataataacagttgaacgtttggtaagtgccaa |
26018329 |
T |
 |
| Q |
213 |
gctactagttgtagcttttggtt |
235 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
26018328 |
gctactagttgtagcttttggtt |
26018306 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University