View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9194_low_2 (Length: 439)
Name: NF9194_low_2
Description: NF9194
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9194_low_2 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 278; Significance: 1e-155; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 278; E-Value: 1e-155
Query Start/End: Original strand, 44 - 433
Target Start/End: Complemental strand, 36943620 - 36943235
Alignment:
| Q |
44 |
attcaagatggtgttggacttcttgattgacatatataattgtctcttgatgaaccagatatatatgaatgatgctaatgagggagaaaagatttaatca |
143 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||| || |||||| | ||||||||| ||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
36943620 |
attcaagatggttttggacttcttgattgacatag----ttttctcttaacgaaccagatttatatgaatgatgctaatgagggagaaaagatttaatta |
36943525 |
T |
 |
| Q |
144 |
gttaacattagacaataatttattagcgacacttgtgaattgttggctattgcatagagacaaatgcttgttttgagtttttt-caatgatgattttgtt |
242 |
Q |
| |
|
||||||||||||||||||||||||||||| |||| |||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
36943524 |
gttaacattagacaataatttattagcgatacttctgaattgttggctattgcatagagacaaatgcttgttttgagtttttttcaatgatgattttgtt |
36943425 |
T |
 |
| Q |
243 |
gatatcctataatgatttaaaatgtatttatgaaattatgattgttgtaattatataacgatgaagaattatcaacgcctctttcttttcaataatttat |
342 |
Q |
| |
|
|||||||||||||||||||||||||||| |||| ||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
36943424 |
gatatcctataatgatttaaaatgtatt-atgacattatgattgttgtaattatataacgatgaagaattatcaatgcctctttcttttcaataatttat |
36943326 |
T |
 |
| Q |
343 |
taacggatttaggccgtatcgtatccttaatttcaaaaatattgtgtatctcatctatcgatctcacctgcacactgcgtatctctgcttc |
433 |
Q |
| |
|
|||||| ||||||| |||| ||||||||||||||||||||||||||||| | ||||||||||| |||| ||||||| |||||||| ||||| |
|
|
| T |
36943325 |
taacgggtttaggctgtattgtatccttaatttcaaaaatattgtgtatttgatctatcgatcccacccgcacactacgtatctcagcttc |
36943235 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University