View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9195_high_4 (Length: 226)
Name: NF9195_high_4
Description: NF9195
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9195_high_4 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 134; Significance: 7e-70; HSPs: 3)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 134; E-Value: 7e-70
Query Start/End: Original strand, 1 - 209
Target Start/End: Original strand, 41090736 - 41090942
Alignment:
| Q |
1 |
tcatctgtttca-agtccccaagtgctacaaaatcttcatcaaatggtggcgttcaccttcaccggtggtagtggcacctcagccagtcaatgaggtcca |
99 |
Q |
| |
|
|||||||||||| |||||| || |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
41090736 |
tcatctgtttcatagtccctaattgctacaaaatcttcatcaaatggtggcgttcaccttcaccggtggtagtggcaccgcagccagtcaatgaggtcca |
41090835 |
T |
|
| Q |
100 |
gatgggtccagtttgaagccgagnnnnnnnnnnnnnnnnncaccatccaggtagctactttcacttgtatctgttgtttcatatgttgttgattctattt |
199 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41090836 |
gatgggtccagtttgaagccgag---gaagaagaagaagacaccatccaggtagctactttcacttgtatctgttgtttcatatgttgttgattctattt |
41090932 |
T |
|
| Q |
200 |
tatcaatatt |
209 |
Q |
| |
|
|||||||||| |
|
|
| T |
41090933 |
tatcaatatt |
41090942 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 45 - 119
Target Start/End: Original strand, 41100951 - 41101025
Alignment:
| Q |
45 |
ggtggcgttcaccttcaccggtggtagtggcacctcagccagtcaatgaggtccagatgggtccagtttgaagcc |
119 |
Q |
| |
|
||||||||||||| ||||||| | |||||||||| ||||||| ||||||| ||||||| |||||||||||||| |
|
|
| T |
41100951 |
ggtggcgttcaccctcaccggcgacagtggcacctgagccagttaatgaggcccagatgcttccagtttgaagcc |
41101025 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 22 - 117
Target Start/End: Original strand, 41079328 - 41079423
Alignment:
| Q |
22 |
gtgctacaaaatcttcatcaaatggtggcgttcaccttcaccggtggtagtggcacctcagccagtcaatgaggtccagatgggtccagtttgaag |
117 |
Q |
| |
|
||||||| ||||||||||||| |||||||||||| | ||||||| | |||||| ||| || | | ||||||||| |||||| |||||||||||| |
|
|
| T |
41079328 |
gtgctacgaaatcttcatcaagtggtggcgttcatcctcaccggcgacagtggcgcctgagacgggtaatgaggtcgagatggttccagtttgaag |
41079423 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University