View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9196_low_6 (Length: 363)
Name: NF9196_low_6
Description: NF9196
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9196_low_6 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 259; Significance: 1e-144; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 259; E-Value: 1e-144
Query Start/End: Original strand, 82 - 348
Target Start/End: Original strand, 10546356 - 10546622
Alignment:
| Q |
82 |
atgagagagatagagattatctaacactgataactttagggataaatagattatctaacactgattgcgcctcccgttttagatagactcaaataggatc |
181 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10546356 |
atgagagagatggagattatctaacactgataactttaggcataaatagattatctaacactgattgcgcctcccgttttagatagactcaaataggatc |
10546455 |
T |
|
| Q |
182 |
ttgcttttgtaaaatgaaaacaatatttcttttactttggtgcagatgcatatctcatagtcttatattggtcagtttattatatttgtatgtagatgga |
281 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10546456 |
ttgcttttgtaaaatgaaaacaatatttcttttactttggtgcagatgcatatctcatagtcttatattggtcagtttattatatttgtatgtagatgga |
10546555 |
T |
|
| Q |
282 |
tctgaagagctttcggttggattatcaaaatggaatgaagtgaaccatggattttgtgaaatctctg |
348 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10546556 |
tctgaagagctttcggttggattatcaaaatggaatgaagtgaaccatggattttgtgaaatctctg |
10546622 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 74; Significance: 7e-34; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 74; E-Value: 7e-34
Query Start/End: Original strand, 163 - 348
Target Start/End: Complemental strand, 30032432 - 30032242
Alignment:
| Q |
163 |
gatagactcaaataggatcttgcttttgtaaaatgaaaacaatatttctttt--------actttggtgcagatgcatatctcatagtcttatattggtc |
254 |
Q |
| |
|
||||| |||||||| ||||||||||||||||||||||||||||||| |||| |||| | |||||| || ||||||| |||||| ||||| |
|
|
| T |
30032432 |
gatagcctcaaataacatcttgcttttgtaaaatgaaaacaatattttttttttgtttttacttcgttgcagacatatgtctcataatcttat--tggtc |
30032335 |
T |
|
| Q |
255 |
agtttattatatttgtatgtagatggatctgaagagctttcggttggattatcaaaatggaatgaagtgaaccatggattttgtgaaatctctg |
348 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||||||| |||||||||||||| | | ||||||| ||||| |||||||||||||| |||| |
|
|
| T |
30032334 |
agtttattat-tttgtatgtagatggatctgaagagctttcagttggattatcaaattcggatgaagttaaccacggattttgtgaaatatctg |
30032242 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University