View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9198_low_11 (Length: 433)
Name: NF9198_low_11
Description: NF9198
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9198_low_11 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 397; Significance: 0; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 397; E-Value: 0
Query Start/End: Original strand, 3 - 415
Target Start/End: Complemental strand, 3055269 - 3054857
Alignment:
| Q |
3 |
cgagtttggtgttgggaaatgaaggaaaagggtcgttgaaaacggttattgttgtcgtttctgtgattgttccggttattttggtatttttgatagccag |
102 |
Q |
| |
|
||||||||||| ||||||||| |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3055269 |
cgagtttggtggagggaaatgatggaaaagggtcgttgaaaacggttattgttgtcgttgctgtgattgttccggttattttggtatttttgatagccag |
3055170 |
T |
|
| Q |
103 |
tattgttggttgggtgatagtgaagaggaaaaggaagaattgtgatgaagggcttgatgaatatggtataccatttccgaagaaatttgatttggataaa |
202 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3055169 |
tattgttggttgggtgatagtgaagaggaaaaggaagaattgtgatgaagggcttgatgaatatggtataccatttccgaagaaatttgatttggataaa |
3055070 |
T |
|
| Q |
203 |
gcaacaatacctagaagatttgaatatagtgaattagttgcagctactaatggttttgatgatgatagaatgcttggaagaggaggatatggacaagttt |
302 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3055069 |
gcaacaatacctagaagatttgaatatagtgaattagttgcagctactaatggttttgatgatgatagaatgcttggaagaggaggatatggacaagttt |
3054970 |
T |
|
| Q |
303 |
acaaaggtgctttgagttatttaggaaagattgttgctgtgaagaggatttttgccgattttgagaattcagaaagagttttcatcaatgaggttaggat |
402 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3054969 |
acaaaggtgctttgagttatttaggaaagattgttgctgtgaagaggatttttgccgattttgagaattcagaaagagttttcatcaatgaggttaggat |
3054870 |
T |
|
| Q |
403 |
tataagccgtttg |
415 |
Q |
| |
|
||||||||||||| |
|
|
| T |
3054869 |
tataagccgtttg |
3054857 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University