View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9199_low_11 (Length: 227)
Name: NF9199_low_11
Description: NF9199
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9199_low_11 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 145; Significance: 2e-76; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 145; E-Value: 2e-76
Query Start/End: Original strand, 1 - 222
Target Start/End: Original strand, 29392263 - 29392472
Alignment:
| Q |
1 |
agaagaatcacatgagaaatgaaatttaggtaannnnnnngcaaggacaacccactagcttaattatagataagtttatatgattaaaatat--gtaagt |
98 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
29392263 |
agaagaatcacatgagaaatgaaatttaggtaatttttttgcaaggacaacccactagcttaattatagataagtttatatgattaaaatatatgtaagt |
29392362 |
T |
 |
| Q |
99 |
ttgataaaatttattatttcatgaacttgcagcattcttttcactagcttatatcatttttcatatattattttaaatagagtttaagcttaaaattata |
198 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
29392363 |
ttgataaaatttattatttcatgaacttgcagcattcttttcactagcttatatc--------------attttaaatagagtttaagcttaaaattata |
29392448 |
T |
 |
| Q |
199 |
gcatgtctctttttctctgcttct |
222 |
Q |
| |
|
|||||||||||||||||||||||| |
|
|
| T |
29392449 |
gcatgtctctttttctctgcttct |
29392472 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University