View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9200_high_11 (Length: 242)
Name: NF9200_high_11
Description: NF9200
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9200_high_11 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 198; Significance: 1e-108; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 198; E-Value: 1e-108
Query Start/End: Original strand, 1 - 226
Target Start/End: Complemental strand, 15245219 - 15244994
Alignment:
| Q |
1 |
attgactgtaaaattgacttagtcatcaccttccttcacaccttagatatacaattgttggtcaaagaattgatttttggccacactttgtgtttggtga |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| ||||||||||||||||| |||||||| |
|
|
| T |
15245219 |
attgactgtaaaattgacttagtcatcaccttccttcacaccttagatatacaattgttggtccaagaattgacttttggccacactttgtctttggtga |
15245120 |
T |
|
| Q |
101 |
aattgaatgtttcctttttgcatcttcccaccatggacggtaaaccaaggtatttaacgatagccaaaattgcttgcacaactaaaatattagcgattga |
200 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||||||||| ||||||||||||||||||||||||||||||||| ||||||||||||||| |||||| |
|
|
| T |
15245119 |
aattgaatgtttcctttttgcatcttcctaccatggacggtaagccaaggtatttaacgatagccaaaattgcttgcgcaactaaaatattagtgattga |
15245020 |
T |
|
| Q |
201 |
attttgcatccgttgagggacatttt |
226 |
Q |
| |
|
|||||||||||||||||||||||||| |
|
|
| T |
15245019 |
attttgcatccgttgagggacatttt |
15244994 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University