View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9200_low_11 (Length: 347)
Name: NF9200_low_11
Description: NF9200
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9200_low_11 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 234; Significance: 1e-129; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 234; E-Value: 1e-129
Query Start/End: Original strand, 30 - 325
Target Start/End: Complemental strand, 46356840 - 46356542
Alignment:
| Q |
30 |
gagaagcagagaggttgaggtagaagccttcgttggagaagagatcagagctggataatgcggggacaattccgatgagttggagaagaggagaacggtg |
129 |
Q |
| |
|
||||| |||||||||||||||||||||||||||| || |||||||| ||||||||||| |||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
46356840 |
gagaatcagagaggttgaggtagaagccttcgtttgaaaagagatcggagctggataaagcggggacaattccaatgagttggagaagaggagaacggtg |
46356741 |
T |
 |
| Q |
130 |
gtcgccggtgacacgtgtatcggtgttcattgcttggaggagtttgaggattaggcctggtgttagtgaagccattgttgtgt-----tgtgaattgagt |
224 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
46356740 |
gtcgccggtgacacgtgtatcggtgttcattgcttggaggagtttgaggattaggcctggtgttagtgaagccattgttgtgttgtgttgtgaattgagt |
46356641 |
T |
 |
| Q |
225 |
tgggttgtgtctgtctgagagagatgttatacagagcagtttctgttctcttgtgttgtgttttttgaattcaaaatgttgatttgtccgttgtgcctat |
324 |
Q |
| |
|
||||||||| ||| ||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
46356640 |
tgggttgtg--tgtgtgagagagatgttatacagaggagtttctgttctcttgtgttgtgttttttgaattcaaaatgttgatttgtccgttatgcctat |
46356543 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University