View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9200_low_29 (Length: 230)
Name: NF9200_low_29
Description: NF9200
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9200_low_29 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 190; Significance: 1e-103; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 190; E-Value: 1e-103
Query Start/End: Original strand, 14 - 215
Target Start/End: Original strand, 10193869 - 10194070
Alignment:
| Q |
14 |
gtttggagttagaaagaaacggaagagctgcactaatggaaataggccagacgttttagttgtgcccataaccaatagctgggggattgttggtgacagt |
113 |
Q |
| |
|
||||||||||||||||||| |||||||||| |||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10193869 |
gtttggagttagaaagaaaaggaagagctgaactaatggaaataggccagaagttttagttgtgcccataaccaatagctgggggattgttggtgacagt |
10193968 |
T |
|
| Q |
114 |
taggtgttagttacatatatgatggaaataagtcaataaaagtaagcagtgagggaacttgaggaattgtaacagatctagggaagtttatcccttatct |
213 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10193969 |
taggtgttagttacatatatgatggaaataagtcaataaaagtaagcagtgagggaacttgaggaattgtaacagatctagggaagtttatcccttatct |
10194068 |
T |
|
| Q |
214 |
tt |
215 |
Q |
| |
|
|| |
|
|
| T |
10194069 |
tt |
10194070 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 40; Significance: 0.00000000000008; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 17 - 64
Target Start/End: Complemental strand, 19459359 - 19459312
Alignment:
| Q |
17 |
tggagttagaaagaaacggaagagctgcactaatggaaataggccaga |
64 |
Q |
| |
|
|||||| ||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
19459359 |
tggagtaagaaagaaaaggaagagctgcactaatggaaataggccaga |
19459312 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University