View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9201_low_23 (Length: 334)
Name: NF9201_low_23
Description: NF9201
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9201_low_23 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 222; Significance: 1e-122; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 222; E-Value: 1e-122
Query Start/End: Original strand, 25 - 322
Target Start/End: Original strand, 4176872 - 4177169
Alignment:
| Q |
25 |
tttatcttctcttttttattttggtttccacgttaacatctacgtttctttgtaaatttagattatcccaaaagcggtcttatacattgttgttcaaata |
124 |
Q |
| |
|
|||||||| |||||||||||||||| |||| |||||||||||| ||||||||||||||||| || | |||||| | |||||||| ||||||||||||||| |
|
|
| T |
4176872 |
tttatcttttcttttttattttggtgtccatgttaacatctacatttctttgtaaatttaggttgttccaaaaacagtcttatatattgttgttcaaata |
4176971 |
T |
 |
| Q |
125 |
acacacctccattctatatatgtaagatgtttcttggtgaaatttgcaccagacacggtaaatgtgtcacgtagtacagaattttgatcgtttgatctaa |
224 |
Q |
| |
|
||||| ||||| | |||||||||||||||| ||||||| |||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
4176972 |
acacatctccactttatatatgtaagatgtctcttggtaaaatttgcaccagacacggtaaatgtgtcacgtagtacggaattttgatcgtttgatctaa |
4177071 |
T |
 |
| Q |
225 |
atctactattggtatcaattatgtataaaattgactgtaatatgaacggtttgatctcaaaccaacggtcgaaatcacttacaatgtaaaactctgtg |
322 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |||| |
|
|
| T |
4177072 |
atctactgttggtatcaattatgtataaaattgactgtaatatgaacggtttgatctcaagccaacggtcgaaatcacttacaatgtaaaactttgtg |
4177169 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University