View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9202_low_8 (Length: 310)
Name: NF9202_low_8
Description: NF9202
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9202_low_8 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 259; Significance: 1e-144; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 259; E-Value: 1e-144
Query Start/End: Original strand, 18 - 288
Target Start/End: Complemental strand, 14054309 - 14054039
Alignment:
| Q |
18 |
gtttacgtgtatacgatggatgatgagatttcttgcattctagttttgtatttgaatattgtttgtattgatggattatattggacctgatagtggtgtt |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
14054309 |
gtttacgtgtatacgatggatgatgagatttcttgcattctagttttgtatttgaatattgtttgtattgatgaattatattggacctgatagtggtgtc |
14054210 |
T |
 |
| Q |
118 |
ccgagaagccagctgaattctagggcaacagttttcagtgtatatactacgtattcatgtactatagcatgagagaaaaaagctgcagaagaatgtagaa |
217 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14054209 |
ccgagaagcaagctgaattctagggcaacagttttcagtgtatatactacgtattcatgtactatagcatgagagaaaaaagctgcagaagaatgtagaa |
14054110 |
T |
 |
| Q |
218 |
atatgcaaatcacggtcgtcccattctttttgtttgtcttgtcaccatcttacttctctttttccgcaata |
288 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14054109 |
atatgcaaatcacggtcgtcccattctttttgtttgtcttgtcaccatcttacttctctttttccgcaata |
14054039 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University