View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9203_low_9 (Length: 466)
Name: NF9203_low_9
Description: NF9203
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9203_low_9 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 173; Significance: 8e-93; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 173; E-Value: 8e-93
Query Start/End: Original strand, 141 - 345
Target Start/End: Original strand, 40287257 - 40287461
Alignment:
| Q |
141 |
tatagtgtgatataatgactttttgttttt--gacaaaagtgtgatataatgacttaaaagtaatgaacacaatattaatttaacgataaattaatcagt |
238 |
Q |
| |
|
|||||||||||||||||||||||| ||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| ||||||||| |
|
|
| T |
40287257 |
tatagtgtgatataatgactttttttttttttgacaaaagtgtgatataatgacttaaaagtaatgaacacaatattaatttaatgataatttaatcagt |
40287356 |
T |
|
| Q |
239 |
aaataacacatatcaaaattgtttctaactccaaaacgtgtccatgagattatgaatattttaaaatgttgtttgattatgtcaaatgttactcacttcc |
338 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40287357 |
aaataaca--tatcaaaattgtttctaactccaaaacgtgtccatgagattatgaatattttaaaatgttgtttgattatgtcaaatgttactcacttcc |
40287454 |
T |
|
| Q |
339 |
acccttc |
345 |
Q |
| |
|
||||||| |
|
|
| T |
40287455 |
acccttc |
40287461 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 29; Significance: 0.0000006; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 283 - 339
Target Start/End: Complemental strand, 3914874 - 3914818
Alignment:
| Q |
283 |
tgagattatgaatattttaaaatgttgtttgattatgtcaaatgttactcacttcca |
339 |
Q |
| |
|
||||||||||||||||| ||| || | || |||| |||||||||||||||| ||||| |
|
|
| T |
3914874 |
tgagattatgaatatttcaaattggtcttcgattctgtcaaatgttactcaattcca |
3914818 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University