View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9205_high_2 (Length: 304)
Name: NF9205_high_2
Description: NF9205
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9205_high_2 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 269; Significance: 1e-150; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 269; E-Value: 1e-150
Query Start/End: Original strand, 1 - 288
Target Start/End: Original strand, 21189551 - 21189841
Alignment:
| Q |
1 |
atccaaggataaggtcttcgttatcgagacgaacacggaacatgccgttagggagggattctgtgatgagaccttcgtggacccatttctgctcgctggc |
100 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21189551 |
atccaaggataaggtcttcattatcgagacgaacacggaacatgccgttagggagggattctgtgatgagaccttcgtggacccatttctgctcgctggc |
21189650 |
T |
 |
| Q |
101 |
tttgtcgggggttgaggacttggcggcgacggtgaagatggatggtggagtgaggtttaggggggatggagggcggaggaaggatggggtgcgaaagtgg |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21189651 |
tttgtcgggggttgaggacttggcggcgacggtgaatatggatggtggagtgaggtttaggggggatggagggcggaggaaggatggggtgcgaaagtgg |
21189750 |
T |
 |
| Q |
201 |
agagtgggggtgtggaaagaaaaggagtgggttgtgatg---gtagagggttggcgatggtgaatgattggggcgtggaatgggatggaag |
288 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21189751 |
agagtgggggtgtggaaagaaaaggagtgggttgtgatggtagtagagggttggcgatggtgaatgattggggcgtggaatgggatggaag |
21189841 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University