View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9208_high_4 (Length: 249)
Name: NF9208_high_4
Description: NF9208
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9208_high_4 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 226; Significance: 1e-125; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 226; E-Value: 1e-125
Query Start/End: Original strand, 10 - 247
Target Start/End: Original strand, 16492635 - 16492872
Alignment:
| Q |
10 |
attattctcccttaaaatttctgtattacatttgtcaacctaattttcctgcactatatgacactattatgaatggaatagttggttttggatatcaatt |
109 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| | |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16492635 |
attattctcccttaaaatttctgtattacatttgtcaacctaattttcctgcaatgtatgacactattatgaatggaatagttggttttggatatcaatt |
16492734 |
T |
|
| Q |
110 |
ttcatcttctggttgagaatgttgggattggtttaagattatatctgtatattaattatttggtttaagtataagaaattgtgatttttagaatatttgg |
209 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16492735 |
ttcatcttctggttgacaatgttgggattggtttaagattatatctgtatattaattatttggtttaagtataagaaattgtgatttttagaatatttgg |
16492834 |
T |
|
| Q |
210 |
tttgatctgattatgctcttcatcaagctactacttgg |
247 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16492835 |
tttgatctgattatgctcttcatcaagctactacttgg |
16492872 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University