View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9208_high_5 (Length: 203)
Name: NF9208_high_5
Description: NF9208
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9208_high_5 |
 | |
|
| [»] scaffold0157 (1 HSPs) |
| | |
|
Alignment Details
Target: chr4 (Bit Score: 82; Significance: 6e-39; HSPs: 5)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 82; E-Value: 6e-39
Query Start/End: Original strand, 91 - 179
Target Start/End: Original strand, 12471064 - 12471153
Alignment:
| Q |
91 |
tctatatgcg-agccattttcttttcgttttactattttgccgatctatgttcgtatacaaagacttggttattaataaatttttatgtt |
179 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12471064 |
tctatatgcggagccattttcttttcgttttactattttgccgatctatgttcgtatacaaagacttggttattaataaatttttatgtt |
12471153 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 76; E-Value: 2e-35
Query Start/End: Original strand, 100 - 179
Target Start/End: Original strand, 12467857 - 12467936
Alignment:
| Q |
100 |
gagccattttcttttcgttttactattttgccgatctatgttcgtatacaaagacttggttattaataaatttttatgtt |
179 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12467857 |
gagccattttcttttcgttttactattttaccgatctatgttcgtatacaaagacttggttattaataaatttttatgtt |
12467936 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 139 - 179
Target Start/End: Original strand, 12525522 - 12525562
Alignment:
| Q |
139 |
gttcgtatacaaagacttggttattaataaatttttatgtt |
179 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12525522 |
gttcgtatacaaagacttggttattaataaatttttatgtt |
12525562 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #4
Raw Score: 40; E-Value: 0.00000000000007
Query Start/End: Original strand, 92 - 138
Target Start/End: Original strand, 12470496 - 12470543
Alignment:
| Q |
92 |
ctatatgcg-agccattttcttttcgttttactattttgccgatctat |
138 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12470496 |
ctatatgcggagccattttcttttcgttttactattttgccgatctat |
12470543 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #5
Raw Score: 32; E-Value: 0.000000004
Query Start/End: Original strand, 116 - 179
Target Start/End: Original strand, 12490292 - 12490355
Alignment:
| Q |
116 |
gttttactattttgccgatctatgttcgtatacaaagacttggttattaataaatttttatgtt |
179 |
Q |
| |
|
|||||||| ||||||||||||||||| | | ||||||||||| |||||| ||||||| ||||| |
|
|
| T |
12490292 |
gttttactgctttgccgatctatgttcttgtgcaaagacttggatattaacaaattttaatgtt |
12490355 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0157 (Bit Score: 32; Significance: 0.000000004; HSPs: 1)
Name: scaffold0157
Description:
Target: scaffold0157; HSP #1
Raw Score: 32; E-Value: 0.000000004
Query Start/End: Original strand, 116 - 179
Target Start/End: Complemental strand, 30185 - 30122
Alignment:
| Q |
116 |
gttttactattttgccgatctatgttcgtatacaaagacttggttattaataaatttttatgtt |
179 |
Q |
| |
|
|||||||| ||||||||||||||||| | | ||||||||||| |||||| ||||||| ||||| |
|
|
| T |
30185 |
gttttactgctttgccgatctatgttcttgtgcaaagacttggatattaacaaattttaatgtt |
30122 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University