View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9208_low_7 (Length: 452)
Name: NF9208_low_7
Description: NF9208
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9208_low_7 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 256; Significance: 1e-142; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 256; E-Value: 1e-142
Query Start/End: Original strand, 114 - 435
Target Start/End: Complemental strand, 19468575 - 19468255
Alignment:
| Q |
114 |
actaaaaggttttcttcaaactcctcgaggtttgtagaacttaccatctttatgaggattaggggcagtgggaaatgttaaatgaacttcaccatatgaa |
213 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
19468575 |
actaaaaggttttcttcaaactcctcgaggtttgtagaacttaccatctttatgaggattaggggcagtgggaaatgttaaacgaacttcaccatatgaa |
19468476 |
T |
 |
| Q |
214 |
agtccccttacagttctatatacgtcaagtcccgtcataaacttttgcattttggggcaatataggg-cacccatcccactaggatttaccgaattctcc |
312 |
Q |
| |
|
||||||||||||||||||||| |||||| ||| |||||| |||||||||||||||||||||||||| |||||||||||| ||||||| ||||||||||| |
|
|
| T |
19468475 |
agtccccttacagttctatat--gtcaagccccatcataaccttttgcattttggggcaatataggggcacccatcccaccaggatttcccgaattctcc |
19468378 |
T |
 |
| Q |
313 |
atcagtgtggtatataacaaatagcaataaaatgaggatagtacgagaaaaataccttccaagttaggattggaagattaatcatgaagaaatcttcatg |
412 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
19468377 |
atcagtgtggtatataaaaaatagcaataaaatgaggatagtacgagaaaaataccttcgaagttaggattggaagattaatcaggaagaaatcttcata |
19468278 |
T |
 |
| Q |
413 |
tttctgtcaaacatcagagtaca |
435 |
Q |
| |
|
||||| |||||||||| |||||| |
|
|
| T |
19468277 |
tttctttcaaacatcaaagtaca |
19468255 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University