View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9209_low_11 (Length: 244)
Name: NF9209_low_11
Description: NF9209
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9209_low_11 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 201; Significance: 1e-110; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 201; E-Value: 1e-110
Query Start/End: Original strand, 13 - 225
Target Start/End: Complemental strand, 22814575 - 22814363
Alignment:
| Q |
13 |
tttcgtgttttgtaggtttcttgtggttcatatgattttccgggttcacagctgaatttctcttatcaacaagataaactgtctccaactatgtcaacag |
112 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
22814575 |
tttcgtgttttgtaggtttcttgtggttcatatgattttccgggttcacagctgaatttctcttatcagcaagataaactgtctccaactatgtcaacag |
22814476 |
T |
|
| Q |
113 |
gaaatgtctcaactaattccggaaaccctgcttgtaatggatcatccgtttctagtaaaacacgaataagatggactcaagatcttcatgagaagtttgt |
212 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22814475 |
gaaatgtctcaactaattccggaaaccctgcttgtaatggatcatcggtttctagtaaaacacgaataagatggactcaagatcttcatgagaagtttgt |
22814376 |
T |
|
| Q |
213 |
cgagtgtgtgaat |
225 |
Q |
| |
|
|||||||||||| |
|
|
| T |
22814375 |
tgagtgtgtgaat |
22814363 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 147 - 225
Target Start/End: Complemental strand, 22811350 - 22811272
Alignment:
| Q |
147 |
taatggatcatccgtttctagtaaaacacgaataagatggactcaagatcttcatgagaagtttgtcgagtgtgtgaat |
225 |
Q |
| |
|
||||| |||||| ||||| ||||| ||| |||||| |||||||| ||||||||||| |||||||| |||| ||||||| |
|
|
| T |
22811350 |
taatgcatcatcggtttcaagtaatacaagaataacatggactcctgatcttcatgacaagtttgttgagtctgtgaat |
22811272 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 38; Significance: 0.000000000001; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 160 - 221
Target Start/End: Complemental strand, 36941659 - 36941598
Alignment:
| Q |
160 |
gtttctagtaaaacacgaataagatggactcaagatcttcatgagaagtttgtcgagtgtgt |
221 |
Q |
| |
|
||||| ||||||||| |||| ||||||||| | |||||||||||||||||||| |||||||| |
|
|
| T |
36941659 |
gtttcaagtaaaacaagaattagatggactaaggatcttcatgagaagtttgttgagtgtgt |
36941598 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University