View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9211_low_13 (Length: 211)
Name: NF9211_low_13
Description: NF9211
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9211_low_13 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 69; Significance: 4e-31; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 69; E-Value: 4e-31
Query Start/End: Original strand, 55 - 123
Target Start/End: Original strand, 25377637 - 25377705
Alignment:
| Q |
55 |
ttaaaacattttaccaatgtatagtctgcattaaatccatcattctcatttacatgctttgtttttgtc |
123 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25377637 |
ttaaaacattttaccaatgtatagtctgcattaaatccatcattctcatttacatgctttgtttttgtc |
25377705 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 69; E-Value: 4e-31
Query Start/End: Original strand, 127 - 195
Target Start/End: Original strand, 25377736 - 25377804
Alignment:
| Q |
127 |
taacacttcttggcatagttgtttgaagaaattgaagtggtgatcaaattaatccatgctgtttagagt |
195 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25377736 |
taacacttcttggcatagttgtttgaagaaattgaagtggtgatcaaattaatccatgctgtttagagt |
25377804 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University