View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9211_low_4 (Length: 395)
Name: NF9211_low_4
Description: NF9211
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9211_low_4 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 110; Significance: 3e-55; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 110; E-Value: 3e-55
Query Start/End: Original strand, 1 - 122
Target Start/End: Complemental strand, 18919600 - 18919479
Alignment:
| Q |
1 |
ttcaaataggtaacattgaagatgccaaagttatcaattaaatcttcactgaattggagttaatttgtcgatctgaaccgaatgaacatccaacgagacg |
100 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
18919600 |
ttcaaataggtaacattgaagacgccaaagttatcaattgaatcttcactgaattggagttaatttgtcgatctgaaccgaatgaacatccaacgagacg |
18919501 |
T |
 |
| Q |
101 |
gaaaaacaaaagaaagccgcat |
122 |
Q |
| |
|
|||||| ||||||||||||||| |
|
|
| T |
18919500 |
gaaaaagaaaagaaagccgcat |
18919479 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 102; E-Value: 1e-50
Query Start/End: Original strand, 229 - 370
Target Start/End: Complemental strand, 18919372 - 18919231
Alignment:
| Q |
229 |
cgattgagagggattatttcggacaaaaagttagccctaaaccacccctctggaatgaatgaggaaaacaaagatagatggnnnnnnnntggttctatct |
328 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
18919372 |
cgattgagagggattatttcggacaaaaagttagccctaaaccacccctctggaatgaatgaggaaaacaaagatagatgaaaaaaaaatggttctatct |
18919273 |
T |
 |
| Q |
329 |
tattcttcaaccaccaaactttcattacttgaagatgcaatt |
370 |
Q |
| |
|
|||||||||||||||||||||||||||| | || |||||||| |
|
|
| T |
18919272 |
tattcttcaaccaccaaactttcattacataaaaatgcaatt |
18919231 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University