View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9213_low_5 (Length: 333)
Name: NF9213_low_5
Description: NF9213
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9213_low_5 |
 | |
|
| [»] chr2 (2 HSPs) |
| |
|
Alignment Details
Target: chr2 (Bit Score: 134; Significance: 1e-69; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 134; E-Value: 1e-69
Query Start/End: Original strand, 200 - 333
Target Start/End: Original strand, 32094036 - 32094169
Alignment:
| Q |
200 |
ataggtgagagagagtgaattgctacaatggcaaacaagatggaaaaaatggcatcaattgatgcacagcttaggcaattggttcctgcaaaagtgagtg |
299 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32094036 |
ataggtgagagagagtgaattgctacaatggcaaacaagatggaaaaaatggcatcaattgatgcacagcttaggcaattggttcctgcaaaagtgagtg |
32094135 |
T |
|
| Q |
300 |
aagatgataaacttattgagtatgatgctttgtt |
333 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
32094136 |
aagatgataaacttattgagtatgatgctttgtt |
32094169 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 18 - 74
Target Start/End: Original strand, 32093854 - 32093910
Alignment:
| Q |
18 |
atattcatcatgtcaaatctctttcataattttcgggatttgattataatttaagga |
74 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32093854 |
atattcaacatgtcaaatctctttcataattttcgggatttgattataatttaagga |
32093910 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 58; Significance: 2e-24; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 242 - 331
Target Start/End: Original strand, 22564702 - 22564791
Alignment:
| Q |
242 |
gaaaaaatggcatcaattgatgcacagcttaggcaattggttcctgcaaaagtgagtgaagatgataaacttattgagtatgatgctttg |
331 |
Q |
| |
|
||||| |||||||| || ||||| |||||| |||||||||||||||||||||||||||| ||||||||||| ||||||||||||||||| |
|
|
| T |
22564702 |
gaaaagatggcatccatcgatgctcagcttcggcaattggttcctgcaaaagtgagtgaggatgataaactggttgagtatgatgctttg |
22564791 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 208 - 237
Target Start/End: Complemental strand, 24586583 - 24586554
Alignment:
| Q |
208 |
gagagagtgaattgctacaatggcaaacaa |
237 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
24586583 |
gagagagtgaattgctacaatggcaaacaa |
24586554 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University