View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF9213_low_5 (Length: 333)

Name: NF9213_low_5
Description: NF9213
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF9213_low_5
NF9213_low_5
[»] chr2 (2 HSPs)
chr2 (200-333)||(32094036-32094169)
chr2 (18-74)||(32093854-32093910)
[»] chr8 (2 HSPs)
chr8 (242-331)||(22564702-22564791)
chr8 (208-237)||(24586554-24586583)


Alignment Details
Target: chr2 (Bit Score: 134; Significance: 1e-69; HSPs: 2)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 134; E-Value: 1e-69
Query Start/End: Original strand, 200 - 333
Target Start/End: Original strand, 32094036 - 32094169
Alignment:
200 ataggtgagagagagtgaattgctacaatggcaaacaagatggaaaaaatggcatcaattgatgcacagcttaggcaattggttcctgcaaaagtgagtg 299  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
32094036 ataggtgagagagagtgaattgctacaatggcaaacaagatggaaaaaatggcatcaattgatgcacagcttaggcaattggttcctgcaaaagtgagtg 32094135  T
300 aagatgataaacttattgagtatgatgctttgtt 333  Q
    ||||||||||||||||||||||||||||||||||    
32094136 aagatgataaacttattgagtatgatgctttgtt 32094169  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 18 - 74
Target Start/End: Original strand, 32093854 - 32093910
Alignment:
18 atattcatcatgtcaaatctctttcataattttcgggatttgattataatttaagga 74  Q
    ||||||| |||||||||||||||||||||||||||||||||||||||||||||||||    
32093854 atattcaacatgtcaaatctctttcataattttcgggatttgattataatttaagga 32093910  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8 (Bit Score: 58; Significance: 2e-24; HSPs: 2)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 242 - 331
Target Start/End: Original strand, 22564702 - 22564791
Alignment:
242 gaaaaaatggcatcaattgatgcacagcttaggcaattggttcctgcaaaagtgagtgaagatgataaacttattgagtatgatgctttg 331  Q
    ||||| |||||||| || ||||| |||||| |||||||||||||||||||||||||||| |||||||||||  |||||||||||||||||    
22564702 gaaaagatggcatccatcgatgctcagcttcggcaattggttcctgcaaaagtgagtgaggatgataaactggttgagtatgatgctttg 22564791  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 208 - 237
Target Start/End: Complemental strand, 24586583 - 24586554
Alignment:
208 gagagagtgaattgctacaatggcaaacaa 237  Q
    ||||||||||||||||||||||||||||||    
24586583 gagagagtgaattgctacaatggcaaacaa 24586554  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University