View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9215_high_1 (Length: 387)
Name: NF9215_high_1
Description: NF9215
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9215_high_1 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 276; Significance: 1e-154; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 276; E-Value: 1e-154
Query Start/End: Original strand, 16 - 333
Target Start/End: Original strand, 8742266 - 8742582
Alignment:
| Q |
16 |
gttgattctcttttaaatctaggggtgacattaaaaactgttaaggggaagaaaccaaagcagctagaaaaaacttgtttggttggctgtcacttagtgt |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8742266 |
gttgattctcttttaaatctaggggtgacattaaaatctgttaagggaaagaaaccaaagcagctagaaaaaacttgtttggttggctgtcacttagtgt |
8742365 |
T |
 |
| Q |
116 |
atttggcttattagaaatggagttttattcaacggggaagtagctaattatcaagnnnnnnngtcatttatgtcaaattaaatgtgtatctgaaggttgg |
215 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8742366 |
atttggcttattagaaatggagttttattcaacggggaagtagctaattatcaagtttttt-gtcatttatgtcaaattaaatgtgtatctgaaggttgg |
8742464 |
T |
 |
| Q |
216 |
tttatgaataccgttggtaggcataatggatttgttagttagtttagtatgtcttcagagtttgtgaaattgtattttggactgcagtgatttagtgttt |
315 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8742465 |
tttatgaataccgttggtaggcataatggatttgttagttagtttagtatgtcttcagagtttgtgaaattgtattttggactgcagtgatttagtgttt |
8742564 |
T |
 |
| Q |
316 |
tcttctcagctagagtaa |
333 |
Q |
| |
|
|||||| |||| |||||| |
|
|
| T |
8742565 |
tcttctgagctggagtaa |
8742582 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University