View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9218_low_11 (Length: 329)
Name: NF9218_low_11
Description: NF9218
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9218_low_11 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 175; Significance: 3e-94; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 175; E-Value: 3e-94
Query Start/End: Original strand, 124 - 306
Target Start/End: Complemental strand, 29877325 - 29877143
Alignment:
| Q |
124 |
gtatgaggtgaatcacaaggatacctgcatccatttggcggtatggttgctgatttgagaggttacgaggctgaaacttctcgtggcattggtcgttgcc |
223 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29877325 |
gtatgaggtgaatcgcaaggatacctgcatccatttggcggtatggttgctgatttgagaggttacgaggctgaaacttctcgtggcattggtcgttgcc |
29877226 |
T |
|
| Q |
224 |
gtcgatgaagaaaatcttgtgaggtttttcagaatgctcgatgccatttcacgaaccttaatttcaatcgcaaatcaacaaag |
306 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
29877225 |
gtcgatgaagaaaatcttgtgaggtttttcagaatgctcgatgccatttcacgaaccctaatttcaatcgcaaatcaacaaag |
29877143 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University