View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF9219_high_12 (Length: 334)

Name: NF9219_high_12
Description: NF9219
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF9219_high_12
NF9219_high_12
[»] chr8 (1 HSPs)
chr8 (260-303)||(5120872-5120915)


Alignment Details
Target: chr8 (Bit Score: 40; Significance: 0.0000000000001; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 260 - 303
Target Start/End: Original strand, 5120872 - 5120915
Alignment:
260 accagcagccattgcaggagcaacaagaacattagctttcctca 303  Q
    |||||||||||||||||||||||||||||||||||| |||||||    
5120872 accagcagccattgcaggagcaacaagaacattagccttcctca 5120915  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University