View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9219_low_24 (Length: 402)
Name: NF9219_low_24
Description: NF9219
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9219_low_24 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 305; Significance: 1e-171; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 305; E-Value: 1e-171
Query Start/End: Original strand, 56 - 386
Target Start/End: Original strand, 34020834 - 34021161
Alignment:
| Q |
56 |
ttactatttattggggaggaatactcggggagcggtagggattcgggtggtggtgtaggaggtggttgcggcggtgaaagttgctcatcacaagggtttc |
155 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
34020834 |
ttactatttattggggaggaatactcggggagcggtagggattctggtggtggtgtaggaggtggttgcggcggtgaaagttgttcatcacaagggtttc |
34020933 |
T |
 |
| Q |
156 |
cacaaggacatgatccacatttgatttcaacgtctaatggcttagaagccaatgataattggtctaatttgctagatgaatatgcattaattgtgatgaa |
255 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
34020934 |
cacaaggacatgatccacatttgatttcaacgtctaatggcttagaagccaatgataattggtctaatttgctagatgagtatgcattaattgtgatgaa |
34021033 |
T |
 |
| Q |
256 |
gaaaagaagaagaactattgtaaatatttgagaactatgttttggagacaccattgtatgagtagtgactttgaatttgattgattttgaggcaaggtat |
355 |
Q |
| |
|
||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34021034 |
gaa---aagaagaactattgtaaatatttgagaactatgttttggagacaccattgtatgagtagtgactttgaatttgattgattttgaggcaaggtat |
34021130 |
T |
 |
| Q |
356 |
aatagatagaagagcttgtatatgaagtagg |
386 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
34021131 |
aatagatagaagagcttgtatatgaagtagg |
34021161 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University