View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9219_low_42 (Length: 245)
Name: NF9219_low_42
Description: NF9219
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9219_low_42 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 122; Significance: 1e-62; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 122; E-Value: 1e-62
Query Start/End: Original strand, 5 - 130
Target Start/End: Complemental strand, 52876265 - 52876140
Alignment:
| Q |
5 |
aatgaaaagttaacaagcacacaatatgaaaaaagaacaaatattttactttttatgagaagaaataagacatatgttataccttaaagtgagagttacg |
104 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52876265 |
aatgaaaagttaacaagcacacaatatgaaaaaagaacaaatattttactttttatgagaagaaataagacatatgttataccttaaagtgagagttaca |
52876166 |
T |
 |
| Q |
105 |
atacaattatgcatccccttgaaatg |
130 |
Q |
| |
|
|||||||||||||||||||||||||| |
|
|
| T |
52876165 |
atacaattatgcatccccttgaaatg |
52876140 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 199 - 245
Target Start/End: Complemental strand, 52876071 - 52876025
Alignment:
| Q |
199 |
ttgaattgactagtttcatatgacacattttttatagtaaagaaaaa |
245 |
Q |
| |
|
|||||||||||| |||||||||| ||||||||||||||||||||||| |
|
|
| T |
52876071 |
ttgaattgactaatttcatatgatacattttttatagtaaagaaaaa |
52876025 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University