View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9220_high_18 (Length: 418)
Name: NF9220_high_18
Description: NF9220
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9220_high_18 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 369; Significance: 0; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 369; E-Value: 0
Query Start/End: Original strand, 14 - 394
Target Start/End: Complemental strand, 46229799 - 46229419
Alignment:
| Q |
14 |
agaagcagagatagcattgatggatccaaaagagtagctagggataacatccgtagctaatctaagtgaatcttgaacaagtgtggcagagtaagtcgaa |
113 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46229799 |
agaaccagagatagcattgatggatccaaaagagtagctagggataacatccgtagctaatctaagtgaatcttgaacaagtgtggcagagtaagtcgaa |
46229700 |
T |
 |
| Q |
114 |
cctgcgtaagatttgttgaaggaacatgcgccagagcccgtggctggacatgagagcccacggacctgactgcattgtggaacggaacactccaatggca |
213 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46229699 |
cctgcgtaagatttgttgaaggaacatgcgccagagcccgtggctggacatgagagcccacggacctgactgcattgtggaacggaacactccaatggca |
46229600 |
T |
 |
| Q |
214 |
cataagtggtggaggcattgggcgagaaagttgttgcggagcaaccaatgcagccagagctagggataaaagcctcgtcggtgcttgtgtcaaggaccat |
313 |
Q |
| |
|
||||| |||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46229599 |
cataactggtggaggcattgggtgagaaagttgttgcggagcaaccaatgcagccagagctagggataaaagcctcgtcggtgcttgtgtcaaggaccat |
46229500 |
T |
 |
| Q |
314 |
gaagaggagttgaccgggtgttccgattttaacacggactatgtagttgccaatgttgaaggcctggcccgaagcaattgg |
394 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46229499 |
gaagaggagttgaccgggtgttccgattttaacacggactatgtagttgccaatgttgaaggcctggcccgaagcaattgg |
46229419 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University