View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9220_high_22 (Length: 361)
Name: NF9220_high_22
Description: NF9220
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9220_high_22 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 248; Significance: 1e-137; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 248; E-Value: 1e-137
Query Start/End: Original strand, 1 - 260
Target Start/End: Complemental strand, 29062577 - 29062318
Alignment:
| Q |
1 |
atcgctgtgggtgggcctaagaggactggtgaagtgaaagttgagaggtggggggatgagttgaaacgagccggatttcgacccgtttcattaaggggta |
100 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
29062577 |
atcgctgtgggtggacctaagaggactggtgaagtgaaagttgagaggtggggggatgagttgaaacgggccggatttcgacccgtttcattaaggggta |
29062478 |
T |
|
| Q |
101 |
acccggcttctcaggcgagtttgttgttggggatgtttccttggagagggtatactttggtggaagagaatggttctctcaagcttggttggaaggatct |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29062477 |
acccggcttctcaggcgagtttgttgttggggatgtttccttggagagggtatactttggtggaagagaatggttctctcaagcttggttggaaggatct |
29062378 |
T |
|
| Q |
201 |
ctctttattgattgcgtctgcttggcaaccgtctgatttgattgcttatgtcgattgagt |
260 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
29062377 |
ctctttattgattgcgtctgcttggcaaccgtctgatttgattgcttatgttgattgagt |
29062318 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University