View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9220_high_31 (Length: 241)
Name: NF9220_high_31
Description: NF9220
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9220_high_31 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 210; Significance: 1e-115; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 210; E-Value: 1e-115
Query Start/End: Original strand, 12 - 225
Target Start/End: Complemental strand, 7067185 - 7066972
Alignment:
| Q |
12 |
acagatccaaagggacaaagttaggctgcttcaagggttgaatttatcagaaggagaaggagatgaaagaggaggtgtgtatgaaactgcaggtatgtta |
111 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7067185 |
acagatccaaagggacaaagttaggctgcttcaagggttgaatttatcagaaggagaaggagatgaaagaggaggtgtgtatgaaactgcaggtatgtta |
7067086 |
T |
 |
| Q |
112 |
tcagagatgtttaattttgctgatccttcaacagctgaattgttagaaaccgcgacgtttcgttcttcgtcttcttcttcttcaagacaactaccacaaa |
211 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7067085 |
tcagagatgtttaattttgctgatccttcaacagctgaattgttagaaaccgcgacgtttcgttcttcgtcttcttcttcttcaagacaactaccacaaa |
7066986 |
T |
 |
| Q |
212 |
caacaacttcagaa |
225 |
Q |
| |
|
||||| |||||||| |
|
|
| T |
7066985 |
caacagcttcagaa |
7066972 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University