View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9220_high_33 (Length: 222)
Name: NF9220_high_33
Description: NF9220
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9220_high_33 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 197; Significance: 1e-107; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 197; E-Value: 1e-107
Query Start/End: Original strand, 1 - 213
Target Start/End: Original strand, 46229795 - 46230007
Alignment:
| Q |
1 |
gttcttcaattccagcccaaggacttttgggcttgggccgtggcccgttatctttattatcacaaaccgggtcactttactcgggtgtattctcctactg |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46229795 |
gttcttcaattccagcccaaggacttttgggcttgggccgtggcccgttatctttattatcacaaaccgggtcactttactcgggtgtattctcctactg |
46229894 |
T |
|
| Q |
101 |
ccttccaagtttcaaatcttactatttttccggatcacttaaacttggacccgtgggtcaacccaaaagcattcgaaccacaccacttcttcgcaatcct |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46229895 |
ccttccaagtttcaaatcttactatttttccgggtcacttaaacttggacccgtgggtcaacccaaaagcattcgaaccacaccacttcttcgcaatcct |
46229994 |
T |
|
| Q |
201 |
tgatgtccatctc |
213 |
Q |
| |
|
| ||||||||| |
|
|
| T |
46229995 |
cgccgtccatctc |
46230007 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University