View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9220_low_29 (Length: 471)
Name: NF9220_low_29
Description: NF9220
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9220_low_29 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 428; Significance: 0; HSPs: 3)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 428; E-Value: 0
Query Start/End: Original strand, 17 - 452
Target Start/End: Complemental strand, 49520408 - 49519973
Alignment:
| Q |
17 |
aaaccaaagatcaatggatggtggaagagacacagagattgcaatgggtgcatttcaacctcatcatctagcatccacatccaatggctcacaaagacca |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49520408 |
aaaccaaagatcaatggatggtggaagagacacagagattgcaatgggtgcatttcaacctcatcatctagcatccacatccaatggctcacaaagacca |
49520309 |
T |
 |
| Q |
117 |
caaggtcaggtgtatggcttcaggagagcattatggtatgaacacattggagataacagcgatgattttgacgagcctgaaaggctggaatgtgtaaaac |
216 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49520308 |
caaggtcaggtatatggcttcaggagagcattatggtatgaacacattggagataacagcgatgattttgacgagcctgaaaggctggaatgtgtaaaac |
49520209 |
T |
 |
| Q |
217 |
ttttgaaccgcgttgctgagaggaattggaaattatactgtgatgatgcattagatgaaagtgtaaatactcaccttttgcgatatcctgttgaagtggg |
316 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49520208 |
ttttgaaccgcgttgctgagaggaattggaaattatactgtgatgatgcattagatgaaagtgtaaatactcaccttttgcgatatcctgttgaagtggg |
49520109 |
T |
 |
| Q |
317 |
tgaagatggaagtgtgacatcactttcagggatgcaatattttcctgatacaatggctttgattcttggttcaaaatctgattaccttcctcccatactt |
416 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49520108 |
tgaagatggaagtgtaacatcactttcagggatgcaatattttcctgatacaatggctttgattcttggttcaaaatctgattaccttcctcccatactt |
49520009 |
T |
 |
| Q |
417 |
accacctagctagctagcacaaggcttgacggccaa |
452 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
49520008 |
accacctagctagctagcacaaggcttgacggccaa |
49519973 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 21 - 76
Target Start/End: Complemental strand, 49509132 - 49509077
Alignment:
| Q |
21 |
caaagatcaatggatggtggaagagacacagagattgcaatgggtgcatttcaacc |
76 |
Q |
| |
|
||||||||||||||||||| |||||||| ||||||||||| |||||||||||||| |
|
|
| T |
49509132 |
caaagatcaatggatggtgcaagagacagtgagattgcaataggtgcatttcaacc |
49509077 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 356 - 424
Target Start/End: Complemental strand, 49508797 - 49508729
Alignment:
| Q |
356 |
ttttcctgatacaatggctttgattcttggttcaaaatctgattaccttcctcccatacttaccaccta |
424 |
Q |
| |
|
|||||||||||| | |||| |||||| ||||| |||||||| ||||||||||| || || |||||||| |
|
|
| T |
49508797 |
ttttcctgatactaaggctaagattctaggttccaaatctgagtaccttcctccaattctcaccaccta |
49508729 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University