View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9220_low_42 (Length: 414)
Name: NF9220_low_42
Description: NF9220
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9220_low_42 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 372; Significance: 0; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 372; E-Value: 0
Query Start/End: Original strand, 14 - 405
Target Start/End: Complemental strand, 6269667 - 6269276
Alignment:
| Q |
14 |
caccttcttgtaaacaggattgtatttaagaagatcatcacttttattagctagattttcttcagagtatttgtatggaacacctttgagtttcaatgca |
113 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6269667 |
caccttcttgtaaacaggattgtatttaagaagatcatcacttttattagctagattttcttcagagtatttgtatggaacacctttgagtttcaatgca |
6269568 |
T |
 |
| Q |
114 |
agatcaattctgttgctaaatggacttgcccattttcctaatagcctcacttcttcttgatttgcagtagccatcccaaaaatgaattttgtacctaaga |
213 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
6269567 |
agatcaattctgttgctaaatggacttgcccattttcctaatagcctcacttcttcttgatttgcagtagccatctcaaaaatgaattttgtacctaaga |
6269468 |
T |
 |
| Q |
214 |
aatgtgatttttagtatatgattgtaatagctttgattaaaagtttttgctgtttatagaggacaaggattagtgtttggtttgtgatgtttttggtcaa |
313 |
Q |
| |
|
||||||| |||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6269467 |
aatgtgaattttaggatatgattgtaatagctttgattaaaagtttttgctgtttatagaggacaaggattagtgtttggtttgtgatgtttttggtcaa |
6269368 |
T |
 |
| Q |
314 |
ctttgatggactagaacatggtgggttggtggctactgagtaggtaagcttcctatcttgaataatctatcatatatctattagagaataat |
405 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6269367 |
ctttgatggactagaacttggtgggttggtggctactgggtaggtaagcttcctatcttgaataatctatcatatatctattagagaataat |
6269276 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University