View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9220_low_59 (Length: 286)
Name: NF9220_low_59
Description: NF9220
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9220_low_59 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 256; Significance: 1e-142; HSPs: 4)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 256; E-Value: 1e-142
Query Start/End: Original strand, 1 - 271
Target Start/End: Complemental strand, 34090486 - 34090215
Alignment:
| Q |
1 |
aaacaattattgtattattaatatgtggatttccccttcgtaacaagtttgttatgtggttcctcataattgtaacgtgtctctcagtgttttgcacagc |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34090486 |
aaacaattattgtattattaatatgtggatttccccttcgtaacaagtttgttatgtggttcctcataattgtaacgtgtctctcagtgttttgcacagc |
34090387 |
T |
 |
| Q |
101 |
tggtgcatatgtgatttctatttggatgatattgaacccac-ttgatggaaccttttatcgtatcacaatttattatggggttttttgggtagggctgat |
199 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
34090386 |
tggtgcatatgtgatttctatttggatgatattgaacccacgttgatggaaccttttatcgtatcacaatttattatgggattttttgggtagggctgat |
34090287 |
T |
 |
| Q |
200 |
tgctttgctgattctcatattcttctgccgctttgtgttttggctgctcaagaacttcttccgttttctgtg |
271 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
34090286 |
tgctttgctgattctcatattcttctgccgctttgtgttttggctgctcaagaacttcttccgttttatgtg |
34090215 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 67; E-Value: 8e-30
Query Start/End: Original strand, 1 - 91
Target Start/End: Complemental strand, 34093459 - 34093369
Alignment:
| Q |
1 |
aaacaattattgtattattaatatgtggatttccccttcgtaacaagtttgttatgtggttcctcataattgtaacgtgtctctcagtgtt |
91 |
Q |
| |
|
||||||| ||||| ||| ||||||||||||||||||||||||||||||||||||||||||| ||||| ||||||||||||||||| ||||| |
|
|
| T |
34093459 |
aaacaataattgtgttactaatatgtggatttccccttcgtaacaagtttgttatgtggttactcatgattgtaacgtgtctctcggtgtt |
34093369 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 52; E-Value: 7e-21
Query Start/End: Original strand, 198 - 265
Target Start/End: Complemental strand, 34093292 - 34093225
Alignment:
| Q |
198 |
attgctttgctgattctcatattcttctgccgctttgtgttttggctgctcaagaacttcttccgttt |
265 |
Q |
| |
|
|||| |||||||||||||||||| ||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
34093292 |
attgttttgctgattctcatatttttctgccgctttgtgttttggctgctcaagatgttcttccgttt |
34093225 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #4
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 23 - 76
Target Start/End: Complemental strand, 34092571 - 34092518
Alignment:
| Q |
23 |
atgtggatttccccttcgtaacaagtttgttatgtggttcctcataattgtaac |
76 |
Q |
| |
|
|||||||||||| |||| |||||||||||||||| ||| ||| ||||||||||| |
|
|
| T |
34092571 |
atgtggatttccacttcttaacaagtttgttatgaggtaccttataattgtaac |
34092518 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University