View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9220_low_62 (Length: 285)
Name: NF9220_low_62
Description: NF9220
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9220_low_62 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 194; Significance: 1e-105; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 194; E-Value: 1e-105
Query Start/End: Original strand, 31 - 276
Target Start/End: Complemental strand, 44104540 - 44104308
Alignment:
| Q |
31 |
tgaaaaattagtggaatagagtgatatatgatgaaatccatttcatctcattccattgtctttccccattgttctttttcctccaatttggaatatatag |
130 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
44104540 |
tgaaaaattagtggaatagagtgatatatgatgaaatccatttcatctcattccattgt-------------tctttttcctccaatttggaatatatag |
44104454 |
T |
 |
| Q |
131 |
gataaaacaagctttctttttacccctatttttgttattttacatcagccctatattcttgcttctgcatcttcaactttgtaccaatttcttagatatt |
230 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44104453 |
gataaaacaagctttctttttaccgctatttttgttattttacatcagccctatattcttgcttctgcatcttcaactttgtaccaatttcttagatatt |
44104354 |
T |
 |
| Q |
231 |
gatttatttgtcgactggtattgtctcattttatcatcacaggttc |
276 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
44104353 |
gatttatttgtcgactggtattgtctcattttatcatcacaagttc |
44104308 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 29; Significance: 0.0000004; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 33 - 77
Target Start/End: Complemental strand, 5092296 - 5092252
Alignment:
| Q |
33 |
aaaaattagtggaatagagtgatatatgatgaaatccatttcatc |
77 |
Q |
| |
|
|||||| |||||||| ||||| |||||||||||||||||| |||| |
|
|
| T |
5092296 |
aaaaatgagtggaatggagtggtatatgatgaaatccattccatc |
5092252 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University