View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9220_low_65 (Length: 243)
Name: NF9220_low_65
Description: NF9220
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9220_low_65 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 199; Significance: 1e-108; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 199; E-Value: 1e-108
Query Start/End: Original strand, 6 - 228
Target Start/End: Original strand, 47151343 - 47151565
Alignment:
| Q |
6 |
gaagcagagacgattaaaaagatggaaattttgatactttcaactcttggatggaagatgagtccagcaacacctctttcttttattgattttatcataa |
105 |
Q |
| |
|
|||||| | |||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47151343 |
gaagcaaaaacgattaaaaagatggaaattttgatactttcaactcttggatggaagatgaatccagcaacacctctttcttttattgattttatcataa |
47151442 |
T |
|
| Q |
106 |
gaagacttggattgaaagatcatctaatttgttgggagttccttaagagatgtgaaggtgttcttctctctgtcattagatcaggtaaatttacagtata |
205 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
47151443 |
gaagacttggattgaaagaccatctaatttgttgggagtttcttaagagatgtgaaggtgttcttctctctgtcattagatcaggtaaattttcagtata |
47151542 |
T |
|
| Q |
206 |
tcttcgatcttgagaaagttttt |
228 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
47151543 |
tcttcgatcttgagaaagttttt |
47151565 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University