View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9221_high_6 (Length: 212)
Name: NF9221_high_6
Description: NF9221
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9221_high_6 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 105; Significance: 1e-52; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 105; E-Value: 1e-52
Query Start/End: Original strand, 91 - 195
Target Start/End: Original strand, 38814350 - 38814454
Alignment:
| Q |
91 |
gcagatatccatgagatatcaaaagggaattagcgttgaaatgctctcaatactttctagtgaattatagatcagcttgatattctcttttgtgcaagct |
190 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38814350 |
gcagatatccatgagatatcaaaagggaattagcgttgaaatgctctcaatactttctagtgaattatagatcagcttgatattctcttttgtgcaagct |
38814449 |
T |
|
| Q |
191 |
cattt |
195 |
Q |
| |
|
||||| |
|
|
| T |
38814450 |
cattt |
38814454 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University