View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9221_low_19 (Length: 237)
Name: NF9221_low_19
Description: NF9221
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9221_low_19 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 211; Significance: 1e-116; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 211; E-Value: 1e-116
Query Start/End: Original strand, 1 - 223
Target Start/End: Original strand, 19057619 - 19057841
Alignment:
| Q |
1 |
aggagcaccttgaccatcaactgttccttctccgtatacagcaagaccatttatttttgagaattggacccatgatcttcttttattatctttccatttc |
100 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
19057619 |
aggagcaccttgaccatcaattgttccttctccgtatacagcaagaccatttatttttgagaactggacccatgatcttcttttattatctttccatttc |
19057718 |
T |
 |
| Q |
101 |
caagcctcaatgtctttcggagcggtgattgttcctttaatctgtcaagccaaaaaacagtatccttaacaatgtacaaaactgcatatcatacagaaaa |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19057719 |
caagcctcaatgtctttcggagcggtgattgttcctttaacctgtcaagccaaaaaacagtatccttaacaatgtacaaaactgcatatcatacagaaaa |
19057818 |
T |
 |
| Q |
201 |
ttcgacaaaatagatgaaacaac |
223 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
19057819 |
ttcgacaaaatagatgaaacaac |
19057841 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University