View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9221_low_20 (Length: 230)
Name: NF9221_low_20
Description: NF9221
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9221_low_20 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 169; Significance: 9e-91; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 169; E-Value: 9e-91
Query Start/End: Original strand, 1 - 214
Target Start/End: Original strand, 33432891 - 33433106
Alignment:
| Q |
1 |
attagaaccatcaatctcggacgaagaattagccttcaaattaaatatacaaaaactgttattattatgaga--aaaggaaagggggacacagtaataac |
98 |
Q |
| |
|
|||||||| |||||||||||| ||||||||||||||||||||||||||||||||||||||||||| | || | |||||||||||||||||||||||||| |
|
|
| T |
33432891 |
attagaacaatcaatctcggatgaagaattagccttcaaattaaatatacaaaaactgttattatgaggaaaggaaaggaaagggggacacagtaataac |
33432990 |
T |
|
| Q |
99 |
caggtaaggtaaggtcgattatatgttacctggattagaggacaactaacgttggcttcctggatgatctcaacagagggagttgtttccattccatact |
198 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| ||| ||||||||||||||||||||||||||| |
|
|
| T |
33432991 |
caggtaagttaaggtcgattatatgttacctggattagagaacaactaacgttggcttcctggatgatatcaccagagggagttgtttccattccatact |
33433090 |
T |
|
| Q |
199 |
ttttgaggtaagtttc |
214 |
Q |
| |
|
|||||||||||||||| |
|
|
| T |
33433091 |
ttttgaggtaagtttc |
33433106 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University