View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9222_low_13 (Length: 326)
Name: NF9222_low_13
Description: NF9222
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9222_low_13 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 288; Significance: 1e-161; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 288; E-Value: 1e-161
Query Start/End: Original strand, 18 - 309
Target Start/End: Original strand, 49774243 - 49774534
Alignment:
| Q |
18 |
ggtttattaagccatattgtataattacattcaggacaaacaaggccttgatcagggaactaagtactcctccagagggttctaaagacttgtacttcac |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49774243 |
ggtttattaagccatattgtataattacattcaggacaaacaaggccttgatcagggaactaagtactcctccagagggttctaaagacttgtacttcac |
49774342 |
T |
|
| Q |
118 |
aacacagcactctcagtctttcttaacccaatgtatggcttgcctttggaagcagaacctatcgtattggcgaaatcccccatacagtgcagtgagactt |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49774343 |
aacacagcactctcagtctttcttaacccaatgtatggcttgcctttggaagcagaacctatcgtattggcgaaatcccccatacagtgcagtgagactt |
49774442 |
T |
|
| Q |
218 |
ttattcacaacggtcatagccttcttgttcgggacaatattttggaatattggctcaaaaaggtaccaagccatgttcctaactcgtttctg |
309 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
49774443 |
ttattcacaacggtcatagccttcttgttcgggacaatattttggaatattggctcaaaaaggtaccaagccatgttcctgactcgtttctg |
49774534 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University