View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9222_low_16 (Length: 250)
Name: NF9222_low_16
Description: NF9222
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9222_low_16 |
 | |
|
| [»] chr5 (1 HSPs) |
| |
|
Alignment Details
Target: chr5 (Bit Score: 236; Significance: 1e-130; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 236; E-Value: 1e-130
Query Start/End: Original strand, 15 - 250
Target Start/End: Complemental strand, 3338115 - 3337880
Alignment:
| Q |
15 |
gatctggattatgcggtcaaccccatgccaacttaactacactctgtactctttctttctccatccattatatgcaccaaacctcaccaacaaatatcaa |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3338115 |
gatctggattatgcggtcaaccccatgccaacttaactacactctgtactctttctttctccatccattatatgcaccaaacctcaccaacaaatatcaa |
3338016 |
T |
|
| Q |
115 |
cacttcatcgtctcaattataacaagtcaattaggcacctgtgattaataaataacttgtttatcatgttatccctattatatattgaatttctcttcaa |
214 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3338015 |
cacttcatcgtctcaattataacaagtcaattaggcacctgtgattaataaataacttgtttatcatgttatccctattatatattgaatttctcttcaa |
3337916 |
T |
|
| Q |
215 |
gtttgttgagccctagtttgccattcaaagaatatt |
250 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
3337915 |
gtttgttgagccctagtttgccattcaaagaatatt |
3337880 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University