View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9222_low_19 (Length: 233)
Name: NF9222_low_19
Description: NF9222
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9222_low_19 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 190; Significance: 1e-103; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 190; E-Value: 1e-103
Query Start/End: Original strand, 19 - 220
Target Start/End: Complemental strand, 9606823 - 9606622
Alignment:
| Q |
19 |
ccacaagcatcatacagatgttattataaatcacaaatgcaaatcatattaaaaacacaaacacacaattttaattcaaatagagatactgttgggaatt |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| ||||||||||||||||||||||||| |
|
|
| T |
9606823 |
ccacaagcatcatacagatgttattataaatcacaaatgcaaatcatattaaaaacacaaacacgtaattttaaatcaaatagagatactgttgggaatt |
9606724 |
T |
|
| Q |
119 |
cctctaaaggttaatccatcttcactagaacgatgaagcaaagtatagggcaattgcaccggcccagttcgatttttcaaatcggaatcattgtttcttt |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9606723 |
cctctaaaggttaatccatcttcactagaacgatgaagcaaagtatagggcaattgcaccggcccagttcgatttttcaaatcggaatcattgtttcttt |
9606624 |
T |
|
| Q |
219 |
ct |
220 |
Q |
| |
|
|| |
|
|
| T |
9606623 |
ct |
9606622 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 52; Significance: 6e-21; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 52; E-Value: 6e-21
Query Start/End: Original strand, 96 - 199
Target Start/End: Original strand, 6455737 - 6455840
Alignment:
| Q |
96 |
aaatagagatactgttgggaattcctctaaaggttaatccatcttcactagaacgatgaagcaaagtatagggcaattgcaccggcccagttcgattttt |
195 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||| || |||||||| |||||| | |||||||| |||||||||| || || ||||| || ||||| |
|
|
| T |
6455737 |
aaatagagatactgttgggaattcctctaaaagttaaaccttcttcacttgaacgaaggagcaaagtgtagggcaattcaactggtccagtgcggttttt |
6455836 |
T |
|
| Q |
196 |
caaa |
199 |
Q |
| |
|
|||| |
|
|
| T |
6455837 |
caaa |
6455840 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 50; E-Value: 9e-20
Query Start/End: Original strand, 96 - 177
Target Start/End: Original strand, 6449270 - 6449351
Alignment:
| Q |
96 |
aaatagagatactgttgggaattcctctaaaggttaatccatcttcactagaacgatgaagcaaagtatagggcaattgcac |
177 |
Q |
| |
|
|||||||||||||||||||||||||||| || ||||| || |||||||| |||||| | |||||||| |||||||||||||| |
|
|
| T |
6449270 |
aaatagagatactgttgggaattcctctgaatgttaaaccttcttcacttgaacgaagtagcaaagtgtagggcaattgcac |
6449351 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 42; Significance: 0.000000000000005; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 93 - 170
Target Start/End: Original strand, 42691746 - 42691823
Alignment:
| Q |
93 |
ttcaaatagagatactgttgggaattcctctaaaggttaatccatcttcactagaacgatgaagcaaagtatagggca |
170 |
Q |
| |
|
|||| ||||||||||| || |||||||||||||| |||| ||| || ||||||||| |||||||||||||||| |||| |
|
|
| T |
42691746 |
ttcagatagagatactattaggaattcctctaaaagttagtccttcctcactagaaggatgaagcaaagtataaggca |
42691823 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 98 - 197
Target Start/End: Complemental strand, 42690097 - 42689998
Alignment:
| Q |
98 |
atagagatactgttgggaattcctctaaaggttaatccatcttcactagaacgatgaagcaaagtatagggcaattgcaccggcccagttcgatttttca |
197 |
Q |
| |
|
|||||||| || ||||||||||||||||||||||| || || ||||||| ||||||||||||| || |||||||| || |||||| |||||| |||| |
|
|
| T |
42690097 |
atagagatgctattgggaattcctctaaaggttaacccctcctcactagtgggatgaagcaaagtgtatggcaattgaactggcccaagtcgattgttca |
42689998 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University