View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9222_low_6 (Length: 403)
Name: NF9222_low_6
Description: NF9222
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9222_low_6 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 366; Significance: 0; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 366; E-Value: 0
Query Start/End: Original strand, 23 - 396
Target Start/End: Original strand, 35451061 - 35451434
Alignment:
| Q |
23 |
attgtgtcattgggcagtggagggagtttgcaaaatctgaactggtttcaaagtggggaacggtgtggtgacgtctttcgggttggataagtggattggg |
122 |
Q |
| |
|
|||| |||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35451061 |
attgcgtcattgggcggtggagggagtttgcaaaatctgaactggtttcaaagtggggaacggtgtggtgacgtctttcgggttggataagtggattggg |
35451160 |
T |
 |
| Q |
123 |
gagactcctcactgtcagagttttctgcgtctgttttcaatgtctactcagggtaatcatagcatcacagatatgggagtttcggaagagggaggatggc |
222 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35451161 |
gagactcctcactgtcagagttttctgcgtctgttttcaatgtctactcagggtaatcatagcatcacagatatgggagtttcggaagagggaggatggc |
35451260 |
T |
 |
| Q |
223 |
gatgggtgtttctttggctcaggcggctgtttgtttgggaggaagagatgctcaataaccacatggtgcagttaggcacaatgtcactgatggattagga |
322 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35451261 |
gatgggtgtttctttggctcaggcggctgtttgtttgggaggaagagatgctcaataaccacatggtgcagttaggcacaatgtcactgatggattagga |
35451360 |
T |
 |
| Q |
323 |
agatatgtggagatgggttcttgagtctgaagaaaagttcacggctaagtctacttatgaatttgtctctgctc |
396 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35451361 |
agatatgtggagatgggttcttgagtctgaagaaaagttcacggctaagtctacttatgaatttgtctctgctc |
35451434 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University