View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9223_low_22 (Length: 338)
Name: NF9223_low_22
Description: NF9223
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9223_low_22 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 112; Significance: 1e-56; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 112; E-Value: 1e-56
Query Start/End: Original strand, 207 - 322
Target Start/End: Original strand, 32965441 - 32965556
Alignment:
| Q |
207 |
aatatgcttaattaatgaacccctttaattttcgtttggtttgcttaattcagtttgacttgtatttgactaaagatagaacctttcaaatagccctgat |
306 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32965441 |
aatatgcttaattaatgaacccctttaattttcatttggtttgcttaattcagtttgacttgtatttgactaaagatagaacctttcaaatagccctgat |
32965540 |
T |
 |
| Q |
307 |
ctgtagggaaatatat |
322 |
Q |
| |
|
|||||||||||||||| |
|
|
| T |
32965541 |
ctgtagggaaatatat |
32965556 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 104; E-Value: 8e-52
Query Start/End: Original strand, 15 - 122
Target Start/End: Original strand, 32965253 - 32965360
Alignment:
| Q |
15 |
attcttcataagatgaaggtatatttgcatatagatccttcatttcattatacttttttgttaagttgaataaattccaatattagaccatacacacttt |
114 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32965253 |
attcttcataagatgaaggtatattttcatatagatccttcatttcattatacttttttgttaagttgaataaattccaatattagaccatacacacttt |
32965352 |
T |
 |
| Q |
115 |
acttgatg |
122 |
Q |
| |
|
|||||||| |
|
|
| T |
32965353 |
acttgatg |
32965360 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University