View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9223_low_30 (Length: 313)
Name: NF9223_low_30
Description: NF9223
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9223_low_30 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 275; Significance: 1e-154; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 275; E-Value: 1e-154
Query Start/End: Original strand, 17 - 299
Target Start/End: Complemental strand, 673063 - 672781
Alignment:
| Q |
17 |
agggttcgggattcgatgtatgtctatgtataatgggagaacattctaaagaagaatacaattatgaaacttattcatcactttcgttcattttagaatg |
116 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
673063 |
agggttcgggtttcgatgtatgtctatgtataatgggagaacattctaaagaagaatacaattatgaaacttattcatcactttcgttcattttagaatg |
672964 |
T |
 |
| Q |
117 |
gctatacatgcatgcatgaaacttttttggtcttcgatttcaaacacaattttgcaatcatataaacttgtcaaaagtaagtatcaaaaagtagctaaaa |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
672963 |
gctatacatgcatgcatgaaacttttttggtcttcgatttcaaacacaattttgcaatcatataaacttgtcaaaagtaagtatcaaaaagtagctaaaa |
672864 |
T |
 |
| Q |
217 |
ttttggtctagtcaaattctttcttttctgttggcactcaattagtaatttttaaatttgtgtattgtctctttctaaattct |
299 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
672863 |
ttttggtctagtcaaattctttcttttctgttggtactcaattagtaatttttaaatttgtgtattgtctctttctaaattct |
672781 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University