View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9223_low_37 (Length: 288)
Name: NF9223_low_37
Description: NF9223
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9223_low_37 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 243; Significance: 1e-135; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 243; E-Value: 1e-135
Query Start/End: Original strand, 14 - 271
Target Start/End: Original strand, 1177997 - 1178255
Alignment:
| Q |
14 |
ataattctatattggaagaagaatccaagaacaaccagtcttattattatgatcatacggtaaggattgatttgacttgatggaattggcaacttccttg |
113 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1177997 |
ataattctatattggaagaagaatccaagaacaatcagtcttattattatgatcatacggtaaggattgatttgacttgatggaattggcaacttccttg |
1178096 |
T |
 |
| Q |
114 |
acaatggttgccttgattcatccattctgatcattttcacaagaaaatgcaaaatctcattagaaaa-caattgtgtttatgcatccatgtataatcttc |
212 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
1178097 |
acaatggttgccttgattcatccattctgatcattttcacaagaaaatgcaaaatctcattagaaaaccaattgtgtttatgcatccatgtataatcttc |
1178196 |
T |
 |
| Q |
213 |
attttaatgctagttttcttttagaaagtgatcaagttcgattctccctggtgccaatt |
271 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
1178197 |
attttaatgctagttttcttttagaaagtgatcaggttcgattctccctggtgccaatt |
1178255 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University