View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9223_low_43 (Length: 242)
Name: NF9223_low_43
Description: NF9223
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9223_low_43 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 129; Significance: 7e-67; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 129; E-Value: 7e-67
Query Start/End: Original strand, 1 - 226
Target Start/End: Complemental strand, 42148030 - 42147827
Alignment:
| Q |
1 |
ggatgagtgatatctagaaatctaactactcaagttttgttaaaaaccgttcaaccatctttcgataacacatttttgtcatgattcttcaggtacatgc |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| | |
|
|
| T |
42148030 |
ggatgagtgatatctagaaatctaactactcaagttttgttaaaaaccgttcaaccatcttt-gataacacatttttg---------------------c |
42147953 |
T |
 |
| Q |
101 |
cacatagtacttttatctgcaaaccatatagctttctttgactttcttaggttagattgcatgagcacacaaatattattttgtacnnnnnnncaggaat |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
42147952 |
cacatagtacttttatctgcaaaccatatagctttctttgactttcttaggttagattgcatgagcacacaaatattattttgtactttttttcaggaat |
42147853 |
T |
 |
| Q |
201 |
aattttttgtacttataaataaaagt |
226 |
Q |
| |
|
|||||||||||||||||||||||||| |
|
|
| T |
42147852 |
aattttttgtacttataaataaaagt |
42147827 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University